From: matus [matus@snet.net]
Sent: Tuesday, May 28, 2002 11:37 PM
To: matus@snet.net
Subject: MFD List - Telomere Technology: The End of Mortality

(All, this is an interesting article about Telomeres and their relation to
aging.  It is very propable that we may see the end to the disease known as
aging, and the ability to manipulate the telemore gene may be one of the
keys. - Mike)

Telomere Technology
The End of Mortality
by Bill Walker

from - http://freedom.orlingrabbe.com/lfetimes/telomere.htm

Ever since Gilgamesh, men have searched for herbal and then chemical means
to treat the terminal genetic illness we call old age. Most of the efforts
were fruitless because no one knew what "old age" really was in a chemical
sense. Now we know. The era of fixed lifespans is over. Your life is now
determined by your access to telomere modification technology and your will
to use it.

For those who haven't spent the last few years running DNA gels, telomeres
are the DNA at the very tip of each chromosome. This DNA does not "say"
anything in the genetic code because it contains no "start" codons or
promoters; it just repeats "TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG . . ." and so on
for about 20,000 "letters" (base pairs) in a young human being. This
telomeric DNA is essential for all eukaryotic (chromosome-containing, i.e.
everything above bacteria) cells. It forms a protective cap at the tip of
each chromosome that keeps chromosomes from fusing with other chromosomes at
the tips. Without telomeres, chromosomes can't maintain their individuality.
Fused chromosomes also have trouble dividing and separating into daughter
cells. Like a society without property rights, a cell without telomeres
quickly breaks down and quits functioning properly.

Most of your body cells ("somatic cells", in correct mad scientist jargon)
are steadily losing their telomeres. Each time they divide, your cells don't
replicate the last 50-150 base pairs of the telomere. So your telomeres keep
shortening, from 20,000 DNA base pairs or so at birth to below 5,000 base
pairs. At some critical point your cells will 'senesce'. Senescent cells can
continue to live for a long time, but they can't divide again. Eventually
the random terrorism of entropy kills them, whether from oxidative damage or
DNA repair error. When you run low on functional cells in essential systems
like artery endothelium, you die.

Why has this programmed-self-destruct-bomb-in-each-cell system evolved?
Well, the Gilgamesh Epic (and those from whom the gods receive daily
guidance today) would tell you that "The gods gave death to mankind and kept
life for themselves." This can never be ruled out; perhaps we are at the
nonexistent mercy of immortal and all-powerful sadists. But those of us who
take our paranoia less personally would say that the telomere system exists
because there is a conflict of interest between individual cells and
organisms. Much as politicians evolve to take an ever-increasing share of
the resources and interns of a society for their own reproduction while
producing nothing in return, individual cells can turn cancerous and pursue
their own interests. This is a constant threat to any multicellular
organism. The bigger and longer-lived the living thing, the more chance for
one cell to mutate into a cancer. (One implication of this is that Bowhead
whales, which are the third-heaviest whale and live 200 years, undoubtedly
have much more advanced anti-cancer genes than humans. Maybe we should stop
the Inuit from exterminating the ancient Bowheads with rocket harpoons from
motorboats.) Each cell has complicated systems to detect genetic deviation
and kill itself by cell suicide, but with enough mutations these systems may
be bypassed. So like the replicants in Blade Runner, each of our body cells
has been given a fixed life span, or rather a fixed number of possible
divisions.

When a human cell collects the necessary series of mutations in the p53 and
p16 checkpoints that are supposed to send a cell with irreversibly damaged
DNA into cell suicide ('apoptosis'), it may go out of control and start to
form a tumor. But eventually the cells in this tumor will run out of
telomere and senesce. We call this "spontaneous remission." Presumably this
often happens inside the body and is never even noticed.

Now, not quite every cell works this way. Germ-line cells, sperm- and
egg-producing cells, have to extend the telomeres of the sperm and egg back
to the correct length for a young organism (or the species would die out in
one generation.) So these cells have an enzyme called telomerase that
extends telomeres by adding more TTAGGG repeats at the end of the
chromosome, independent of the normal system of DNA replication. To further
complicate matters, stem cells (the cells that make other cells for repair
and maintenance purposes, like the white-blood-cell-manufacturing cells in
the bone marrow) also activate telomerase some of the time.

Of course every cell has all the same genes as every other cell, because we
all start out as single-celled organisms. Skin cells have the same genes as
brain cells, but different genes are turned on to make different kinds of
cells. So every cell contains the gene for telomerase... and if a cancer
cell can turn that telomerase gene on the cancer becomes immortal. It can
divide until it kills you. In fact it can divide a lot longer than that; we
have HeLa cells still growing in our lab that killed someone named Henrietta
L. back in the 50s.

So there are two themes in telomere modification. One is to lengthen the
telomeres of old somatic cells to reverse aging or cure other genetic
diseases with engineered cells. The other is to shorten telomeres in cancer
cells and kill them. Both of these objectives have been achieved in the
laboratory.


Longer Telomeres
To engineer longer telomeres, we remove a few cells from a patient. Then we
use a virus to carry a telomerase gene into the cells. Now all these cells
already have a telomerase gene, but it is "off" because the DNA upstream of
it has the wrong promoter sequence, one that is not turned on in that type
of cell. The telomerase gene that we carry in with the virus has a different
promoter, one that is expressed. We can use anything from a virus promoter
(sort of like a molecular Don King), which screams "TRANSCRIBE ME!" a
thousand times more loudly than human promoters, or we can use a weaker
promoter and get a slower rate of telomerase molecule production.

Two kinds of engineering viruses are commonly used. Retroviruses insert the
telomerase gene randomly into a chromosome. Of course this occasionally
kills a cell by cutting an important gene, but most of the cells survive.
(The retrovirus is always provided with an antibiotic resistance gene so
that non-infected cells can be killed off in culture, leaving pure
telomerized cells.) It doesn't matter much anyway since telomerase-active
cells can be grown in culture forever until you have as many as the patient
needs. After a large population of cells is produced, other genes may be
introduced to fix genetic diseases, like the gene for the mutant protein
that causes muscular dystrophy. Then we can use another retrovirus which
produces a protein which selectively excises the telomerase gene. At this
point we have a supply of longer-telomere, rejuvenated and genetically
repaired cells ready to reinstall into the patient. Since these cells carry
the patient's own MHC genes, they will not be rejected like foreign
transplants. This sort of technique could cure Duchenne's muscular
dystrophy, AIDs-induced depletion of T cells, and other scarcities of
specialized cell types. Many aging syndromes are caused by depletion of
critical cell types.

Adenoviruses are used to carry telomerase (hTERT) into cells, but the
adeno-hTERT virus doesn't install any genes into the chromosomes.
Adeno-hTERT just sits in the cell producing telomerase, lengthening the
telomeres in the originally infected cells. The longer telomeres (but not
the virus, which eventually succumbs to cellular enzymes... we hope) are
then passed on to daughter cells.

Both viral techniques kill some cells, so are not the ultimate easy answer
for whole-body telomere restoration. For that we need a way, perhaps an
artificial hormone, to temporarily "turn on" the telomerase in each older
cell. Study on this is under way. But the current viral techniques mean that
a healthy 200- year-old need not run out of any cell type that can easily be
removed and cultured. All you need is a cell culture hood and a few
incubators in a country with no FDA. None of the viral techniques we have
now are likely to be FDA-approved before the protons decay (i.e. a long
time), because they involve using the patient's own cells. Thus every
patient uses different cells, so every patient needs his or her own personal
FDA approval. Buddy, can you spare $820 million (Tufts University estimate
of average FDA approval cost)?

Since the only advantage to short telomeres is better cancer control, when
cancer is cured (see the next section) we won't need short telomeres. Then
children (and eventually adults, with more difficulty) can be engineered
with telomeres like current-day lab mice, 100,000 base pairs long, giving
humans inherent life spans like those of the Bibical patriarchs or the
Sumerian demigods. Perhaps this will create people that actually care about
solving the big environmental problems (like asteroid impacts.)


Pinky and the Brain's Telomeres
This brings up a little aside about government lab mice. They've been
selected for a century by intensively breeding them for only eight months in
a low-selection environment.... anyway, however it happened, their telomeres
are over five times as long as those of real animals. So most of the cancer
studies done on mice were compromised; lab mice get cancer really easily
because of their long telomeres. The common lab mouse isn't good for
toxicity studies, either; they're too resistant. Are you shocked that large
amounts of tax money went down a research dead end? Neither is anyone else.


Shorter Telomeres
To cure cancer in a dish, we can use what are called "antisense oligos" to
bind to the RNA molecules that have to be translated into protein to make
the active telomerase molecules. This knocks out telomerase in all the
cells, allowing the telomeres to shorten and the cells to senesce. Except
for the (fortunately small) percentage of cancer types that go into the ALT
pathway, which is another system of telomere lengthening that doesn't use
telomerase. (I hate cancer cells, but you have to admire their persistence
and ingenuity.) Suffice to say that killing cancer this way isn't 100%
effective on every cancer but may be a good adjunct therapy someday, since
it only affects telomerase-positive cells. In an adult human, the only
telomerase- positive cells are sperm-producing cells (eggs are all made in
fetal females and saved for a lifetime), and some of the currently active
stem cells. So an antitelomerase treatment might at worst sterilize a male
while curing his cancer (of course some testicular cells could be removed
first.)

A faster and more promising anti-telomerase technique is to use a lethal
adenovirus with the telomerase promoter instead of the normal "Don King"
viral super-promoter. This means that the viral genes will only be
transcribed in cells which are expressing telomerase, again killing only
male germ-line cells and a proportion of stem cells. Again because of the
existence of the ALT pathway, not every cancer is completely eradicated. But
many are, and this technique has the advantage that the same adenovirus can
be used on everyone. So only one $820 million FDA approval will be needed.


Your Telomeres
There are things you can do to help your telomeres stay at their optimum
length longer. Oxidative damage can increase the rate of telomere shortening
(not to mention damaging your mitochodrial DNA, which works like bacterial
DNA . . . oops, better leave that for another article.) So taking a good mix
of antioxidants can slow down aging to some degree. Go to Pubmed and read
Bruce Ames' latest papers on alpha-lipoic acid. But in the long run, only a
legal regime that allows companies to provide you with telomere-controlling
technologies can solve your telomere problems.

Gilgamesh never did get his telomeres under control in 3000 BC. After many
adventures, he found a rejuvenating herb, but a snake stole it and dived
into a deep well with it. We have a snake problem too, and the life-stealing
snake's name is FDA. Too many biological technologies are lying at the
bottom of the regulatory well, and there isn't enough money on the planet to
fill the well and float them out.

We have telomeres under control in the lab dish, in the cloned cow, and
other places that do your personal telomeres no good. Your telomeres should
be under your control. They are not the only puzzle that must be solved to
reach the end of Gilgamesh's quest, but they are an important piece of the
puzzle. There is no reason that you shouldn't live to be 200, like a Bowhead
whale or like Utnapishtim (the Sumerian Noah... well, actually Noah is the
more recent story's Utnapishtim). Perhaps two more centuries of technology
will bring enough progress to fix the rest of your mortal ailments. It is
certain that the inevitability of human mortality at a certain age is over.


----------------------------------------------------------------------------
----

Bio: Bill Walker works as a hunchbacked assistant in the Shay-Wright
telomere lab at UT Southwestern Medical Center

(http://www.swmed.edu/home_pages/cellbio/shay-wright/index.html).

Every day he lengthens the telomeres of cells in culture while his own
telomeres shorten inexorably.

www.matus1976.com - Article archives
www.matus1976.com - Article archives